Class AffyProbeReader

All Implemented Interfaces:
LineParser<Collection<Reporter>>, Parser<Collection<Reporter>>

public class AffyProbeReader extends BasicLineMapParser<CompositeSequence,Collection<Reporter>>
Reads Affymetrix Probe files, including exon arrays.

Expected format is tabbed, NOT FASTA. A one-line header starting with the word "Probe" is REQUIRED. In later versions of the format the second field of the file (column) is omitted.

For 3' arrays, here is an example:

 1494_f_at 1 325 359 1118 TCCCCATGAGTTTGGCCCGCAGAGT Antisense
 
For exon arrays, we create the equivalent files from the GFF files provided by Affymetrix. The files are created off-line using a PERL script.
Author:
pavlidis